From: A local outbreak of dengue caused by an imported case in Dongguan China
Primers/probe | Sequence (5'-3') | Working concentration | Length of amplified fragment (bp) | Type specificity |
---|---|---|---|---|
Den-FP | GCATATTGACGCTGGGAGAGA | 0.5 μM | 68 | Universal for all four types |
Den-RP | GGCGTTCTGTGCCTGGAAT | 0.5 μM |  |  |
Den-probe | FAMCAGAGATCCTGCTGTCTCMGB | 0.25 μM |  |  |
Real-time PCR program | Pre-denature at 95°C for 45 s, denature at 95°C for 20 s, annealing at 65°C for 20 s, elongation at 72°C for 30 s, 40 cycles, elongation at 72°C for 1 min, keep at 4°C |